Detail of EST/Unigene EY477410 |
Acc. | EY477410 |
Internal Acc. | METB266TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=3e-56; Dihydroflavonol-4-reductase OS=Arabidopsis thaliana E-value=3e-56; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=1e-55; Dihydroflavonol-4-reductase OS=Zea mays E-value=2e-55; Dihydroflavonol-4-reductase OS=Callistephus chinensis E-value=4e-54; |
Length | 733 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | TGAAGGAAAAGGAAGAGTTTGTGTGACTGGAGGTACAGGTTTTCTTGGTTCATGGATTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
EC | 1.1.1.145 1.1.1.170 5.3.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819146 |
Trichome-related Gene from Literature | N/A |