Detail of EST/Unigene EY477588 |
Acc. | EY477588 |
Internal Acc. | METB459TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Short-chain dehydrogenase TIC 32, chloroplastic OS=Pisum sativum E-value=1e-76; Short-chain dehydrogenase TIC 32, chloroplastic OS=Arabidopsis thaliana E-value=2e-75; WW domain-containing oxidoreductase OS=Gallus gallus E-value=1e-31; WW domain-containing oxidoreductase OS=Homo sapiens E-value=2e-30; WW domain-containing oxidoreductase OS=Pongo abelii E-value=7e-30; |
Length | 743 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | TAACTAAGTAGAATACAACATTGTTATTTTTATCCACTCTCACTCTTCACATACCTTACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | ; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K11152 retinol dehydrogenase 11; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K11153 retinol dehydrogenase 12 |
EC | 1.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828441 |
Trichome-related Gene from Literature | N/A |