Detail of EST/Unigene EY477764 |
Acc. | EY477764 |
Internal Acc. | METB650TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calcineurin subunit B OS=Naegleria gruberi E-value=3e-27; Calcineurin subunit B type 1 OS=Dictyostelium discoideum E-value=8e-24; Calcineurin subunit B OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=1e-22; Calcineurin subunit B type 2 OS=Dictyostelium discoideum E-value=4e-22; Calcineurin subunit B OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) E-value=6e-22; |
Length | 750 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | TTCCTAAGTACACTACACTACACTCATCTTTGAATCCCAACTTTCTCAATTCTCATCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K06268 protein phosphatase 3, regulatory subunit |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821372 |
Trichome-related Gene from Literature | N/A |