| Detail of EST/Unigene EY477867 |
| Acc. | EY477867 |
| Internal Acc. | METB764TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=0; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=6e-90; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. japonica E-value=3e-77; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. indica E-value=3e-77; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=1e-76; |
| Length | 699 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | TATCTCTCCAATTTTATTGATAGCTCTCTTCTCTCTTATTTATAGCAATTATGTTATTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820591 |
| Trichome-related Gene from Literature | N/A |