Detail of EST/Unigene EY477894 |
Acc. | EY477894 |
Internal Acc. | METB792TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acylpyruvase FAHD1, mitochondrial OS=Dictyostelium discoideum E-value=4e-62; Acylpyruvase FAHD1, mitochondrial OS=Bos taurus E-value=4e-59; Acylpyruvase FAHD1, mitochondrial OS=Homo sapiens E-value=4e-56; Acylpyruvase FAHD1, mitochondrial OS=Pongo abelii E-value=9e-56; Acylpyruvase FAHD1, mitochondrial OS=Mus musculus E-value=4e-55; |
Length | 596 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | AGAAACTCTTTGATTTAGGCACAAAGAACATCGGCGTCGGTAGAAACTACGCCGCTCACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827276 |
Trichome-related Gene from Literature | N/A |