| Detail of EST/Unigene EY478329 |
| Acc. | EY478329 |
| Internal Acc. | METBD01TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 reductase 4 OS=Rattus norvegicus E-value=3e-17; Cytochrome b5 reductase 4 OS=Danio rerio E-value=3e-17; Cytochrome b5 reductase 4 OS=Mus musculus E-value=4e-17; Cytochrome b5 reductase 4 OS=Homo sapiens E-value=8e-17; Cytochrome b5 reductase 4 OS=Bos taurus E-value=8e-17; |
| Length | 481 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | GATGAAGTTAGAAAGCACAAAACAGAAGGTGAAATGTGGACTGTATTGAAAGGCCGTGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
| EC | 1.14.19.- 1.6.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830827 |
| Trichome-related Gene from Literature | N/A |