| Detail of EST/Unigene EY478377 |
| Acc. | EY478377 |
| Internal Acc. | METBD57TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Secologanin synthase OS=Catharanthus roseus E-value=3e-38; Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=6e-34; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=4e-23; Cytochrome P450 734A6 OS=Oryza sativa subsp. japonica E-value=2e-19; Cytochrome P450 734A5 OS=Oryza sativa subsp. japonica E-value=8e-18; |
| Length | 743 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | AAACAATAATGAATGATTCTTACTTGCCCACACCTACCAAATTCTATAAAGCAATTAGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00490 cytochrome P450, family 4, subfamily F (leukotriene-B4 20-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
| EC | 1.14.13.30 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820690 |
| Trichome-related Gene from Literature | N/A |