| Detail of EST/Unigene EY478467 |
| Acc. | EY478467 |
| Internal Acc. | METBE60TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA reductase OS=Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383) E-value=4e-20; Estradiol 17-beta-dehydrogenase 12 OS=Rattus norvegicus E-value=6e-20; 3-ketoacyl-CoA reductase OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) E-value=7e-20; Putative steroid dehydrogenase let-767 OS=Caenorhabditis briggsae E-value=1e-19; 3-ketoacyl-CoA reductase OS=Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970) E-value=3e-19; |
| Length | 433 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | ACATCAACATGGATTGTTGCATAATCAGTAAACTCAAAACCCAACCATACTGGTTCCTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
| EC | 1.1.1.- 1.1.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843098 |
| Trichome-related Gene from Literature | N/A |