Detail of EST/Unigene EY478541 |
Acc. | EY478541 |
Internal Acc. | METBF40TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-hydroxyisobutyryl-CoA hydrolase 1 OS=Arabidopsis thaliana E-value=1e-84; Probable 3-hydroxyisobutyryl-CoA hydrolase 3 OS=Arabidopsis thaliana E-value=3e-84; Probable 3-hydroxyisobutyryl-CoA hydrolase 2 OS=Arabidopsis thaliana E-value=2e-75; 3-hydroxyisobutyryl-CoA hydrolase-like protein 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-48; 3-hydroxyisobutyryl-CoA hydrolase-like protein 1, mitochondrial OS=Arabidopsis thaliana E-value=2e-48; |
Length | 885 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GTCCTTCCTCTCCCTCAGTCTTCTTCACCAACGACCATGGCATCCCCCGCCAAACTGGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K05605 3-hydroxyisobutyryl-CoA hydrolase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K05605 3-hydroxyisobutyryl-CoA hydrolase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K05605 3-hydroxyisobutyryl-CoA hydrolase |
EC | 3.1.2.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836724 |
Trichome-related Gene from Literature | N/A |