Detail of EST/Unigene FE537146 |
Acc. | FE537146 |
Internal Acc. | 1209 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=5e-14; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=2e-13; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=9e-11; |
Length | 727 nt |
Species | Salvia fruticosa |
Belonged EST Libraries | SF_LTRI (1 ESTs); |
Sequence | GGGGGGCTGAGAAAGAGTTTGTCGATGGTGTCCCACAAAATTTTTGGTGTGAAGATGCCA |
EST members of Unigene | FE537146 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842869 |
Trichome-related Gene from Literature | 842869 |