| Detail of EST/Unigene FE537146 |
| Acc. | FE537146 |
| Internal Acc. | 1209 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=5e-14; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=2e-13; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=9e-11; |
| Length | 727 nt |
| Species | Salvia fruticosa |
| Belonged EST Libraries | SF_LTRI (1 ESTs); |
| Sequence | GGGGGGCTGAGAAAGAGTTTGTCGATGGTGTCCCACAAAATTTTTGGTGTGAAGATGCCA |
| EST members of Unigene | FE537146 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842869 |
| Trichome-related Gene from Literature | 842869 |