Detail of EST/Unigene FF405296 |
Acc. | FF405296 |
Internal Acc. | CT1495 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=2e-42; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=7e-42; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-41; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-41; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=2e-41; |
Length | 370 nt |
Species | Cistus creticus |
Belonged EST Libraries | CC_TRI (1 ESTs); |
Sequence | GGCGGCAACCACAGCAGCTCTTTCCTCTCCCTCCTTGGCCGGAAAGGCGGTAAGGACTCG |
EST members of Unigene | FF405296 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |