Detail of EST/Unigene FG141967 |
Acc. | FG141967 |
Internal Acc. | AGN_RPC023xo07f1.ab1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase kinase ANP1 OS=Arabidopsis thaliana E-value=1e-47; Mitogen-activated protein kinase kinase kinase 2 OS=Arabidopsis thaliana E-value=2e-47; Mitogen-activated protein kinase kinase kinase 3 OS=Arabidopsis thaliana E-value=7e-47; Protein kinase byr2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-44; Mitogen-activated protein kinase kinase kinase 1 OS=Arabidopsis thaliana E-value=3e-43; |
Length | 876 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RPC (1 ESTs); |
Sequence | TCACCAATTCATCCTAGGGCTGTAGGTGGAGCCTCTGAATTGCAGTCTAGTTGGCCTGAT |
EST members of Unigene | FG141967 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K04416 mitogen-activated protein kinase kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04416 mitogen-activated protein kinase kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04421 mitogen-activated protein kinase kinase kinase 3 |
EC | 2.7.11.25 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 842674 |
Trichome-related Gene from Literature | 842674 |