Detail of EST/Unigene FG179385 |
Acc. | FG179385 |
Internal Acc. | AGN_PNL201ar1_h4.trimmed.seq |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=2e-87; Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=2e-87; Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=1e-81; UDP-glycosyltransferase 84A2 OS=Arabidopsis thaliana E-value=8e-70; UDP-glycosyltransferase 84A4 OS=Arabidopsis thaliana E-value=2e-69; |
Length | 701 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL (1 ESTs); |
Sequence | ACGATATGTGGTTATCATTTTAAAAAAATACATTACACCTCGTTTATGGATTGACTAACG |
EST members of Unigene | FG179385 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.17 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821710 |
Trichome-related Gene from Literature | 821710 |