Detail of EST/Unigene FG181894 |
Acc. | FG181894 |
Internal Acc. | AGN_PNL204cr1_e3.trimmed.seq |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Transcription factor AP-1 OS=Serinus canaria E-value=2e-48; Transcription factor AP-1 OS=Rattus norvegicus E-value=2e-48; Transcription factor AP-1 OS=Sus scrofa E-value=2e-48; Transcription factor AP-1 OS=Mus musculus E-value=2e-48; Transcription factor AP-1 OS=Homo sapiens E-value=2e-48; |
Length | 678 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL (1 ESTs); |
Sequence | GGGGTCCAGGCACAACTTGGTCAATGTTAACGCAATGATAGTGTCTCTCTTAAAAAAGAA |
EST members of Unigene | FG181894 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04448 transcription factor AP-1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04448 transcription factor AP-1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04448 transcription factor AP-1 |
EC | |
Transcription Factor Family | bZIP |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830996 |
Trichome-related Gene from Literature | 830996 |