| Detail of EST/Unigene FG183985 |
| Acc. | FG183985 |
| Internal Acc. | AGN_PNL207cf1_d11.trimmed.seq |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=3e-17; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=1e-16; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-16; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=1e-16; Chlorophyll a-b binding protein 13, chloroplastic OS=Petunia sp. E-value=1e-16; |
| Length | 135 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_PNL (1 ESTs); |
| Sequence | GGAATACTGCAACCAAAGTCAACCCTGTCTCTTCTGGCAGCCCGTGGTACAGTCCTGATC |
| EST members of Unigene | FG183985 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |