Detail of EST/Unigene FG643637 |
Acc. | FG643637 |
Internal Acc. | TT-08_A07 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=5e-48; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=7e-47; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=2e-43; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=8e-43; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=3e-42; |
Length | 788 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_K326_LSL (1 ESTs); |
Sequence | AAACTGAACGTACAACGTCCGTCATGTGTTTTAACTTTACCATGTTCTGCTCTGAGAGTG |
EST members of Unigene | FG643637 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |