| Detail of EST/Unigene FG643637 |
| Acc. | FG643637 |
| Internal Acc. | TT-08_A07 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=5e-48; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=7e-47; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=2e-43; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=8e-43; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=3e-42; |
| Length | 788 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_K326_LSL (1 ESTs); |
| Sequence | AAACTGAACGTACAACGTCCGTCATGTGTTTTAACTTTACCATGTTCTGCTCTGAGAGTG |
| EST members of Unigene | FG643637 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836542 |
| Trichome-related Gene from Literature | 836542 |