Detail of EST/Unigene FS181557 |
Acc. | FS181557 |
Internal Acc. | FS181557 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=6e-22; Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=2e-16; Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; |
Length | 147 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_024426; |
Sequence | GGAGAGGTCAGGAACTATTCCTGGTGTTGATATGGTTCATGCTCCAGTTGCTCTCATACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832797 |
Trichome-related Gene from Literature | 832797 |