| Detail of EST/Unigene FS184826 |
| Acc. | FS184826 |
| Internal Acc. | FS184826 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A2 OS=Solanum melongena E-value=5e-16; Cytochrome P450 71B36 OS=Arabidopsis thaliana E-value=2e-14; Cytochrome P450 71B37 OS=Arabidopsis thaliana E-value=6e-14; Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=2e-13; Cytochrome P450 71A4 OS=Solanum melongena E-value=5e-13; |
| Length | 217 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024426; |
| Sequence | ATTTGAATCTCCTTGGTTCACTCCCACATGTATCTTTGCACCATCTTTCGCAAAAATATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822236 |
| Trichome-related Gene from Literature | N/A |