Detail of EST/Unigene FS190235 |
Acc. | FS190235 |
Internal Acc. | FS190235 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=1e-67; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=1e-67; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=1e-67; Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=3e-67; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=3e-67; |
Length | 537 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_024426; |
Sequence | AGTATTTTCCGGCAAGAAAAAAGATGGGTCATTGAGAGGGACTGAAAAATTGAAGAAGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
|
Corresponding NCBI Gene | 829750 |
Trichome-related Gene from Literature | N/A |