| Detail of EST/Unigene FS203191 |
| Acc. | FS203191 |
| Internal Acc. | FS203191 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-22; Gamma-glutamyltranspeptidase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-20; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=9e-18; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=1e-17; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=2e-16; |
| Length | 527 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024426; |
| Sequence | CACTTTTGGACTCTACTTCTCCTCTTTGTTCTAATACAAAGAAAAAATGGAGTTTTTTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
| EC | 2.3.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829042 |
| Trichome-related Gene from Literature | 829042 |