Detail of EST/Unigene FS381734 |
Acc. | FS381734 |
Internal Acc. | FS381734 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=9e-36; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=5e-35; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=1e-34; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=7e-33; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=9e-23; |
Length | 316 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GACGGTGTGCTAAATAAGGTCTTTCACAACATTACAGATACTCACGTTTTGCATCATTTA |
EST members of Unigene | FS381734 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |