Detail of EST/Unigene FS382332 |
Acc. | FS382332 |
Internal Acc. | FS382332 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=3e-47; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-46; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=1e-25; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=1e-25; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=2e-24; |
Length | 411 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GGCGAAAGAGGGAAGATCGAGATAGCAGCAGCTTAAGCAAATAGCAATGGCAACTTTCAT |
EST members of Unigene | FS382332 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.5.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |