Detail of EST/Unigene FS388280 |
Acc. | FS388280 |
Internal Acc. | FS388280 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 750A1 OS=Pinus taeda E-value=8e-35; Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-34; Cytochrome P450 71A9 OS=Glycine max E-value=2e-34; Cytochrome P450 71D8 OS=Glycine max E-value=1e-33; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=2e-33; |
Length | 516 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GATCAGTAATGGAGATTTCCTCGGTTTTCATTACTTTGGGATGCTTACTAGCATTAGCTA |
EST members of Unigene | FS388280 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |