Detail of EST/Unigene FS392947 |
Acc. | FS392947 |
Internal Acc. | FS392947 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=2e-42; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=6e-41; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=8e-21; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=8e-21; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=2e-19; |
Length | 386 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GGAGTCTGAGAAAGAGGGAAGATCGAGATAGCAGCAGCTTAAGCAAATAGCAATGGCAAC |
EST members of Unigene | FS392947 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |