Detail of EST/Unigene FS399961 |
Acc. | FS399961 |
Internal Acc. | FS399961 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=6e-74; Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=2e-73; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=3e-71; dTDP-D-glucose 4,6-dehydratase OS=Mus musculus E-value=7e-37; dTDP-D-glucose 4,6-dehydratase OS=Homo sapiens E-value=4e-35; |
Length | 539 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GGTCTGAATCTCAAATCTCTCTTTCTAAAACCGAAGCACACGACGTAGTTCTTTTTTCCC |
EST members of Unigene | FS399961 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
EC | 4.2.1.46 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820707 |
Trichome-related Gene from Literature | 820707 |