Detail of EST/Unigene FS400069 |
Acc. | FS400069 |
Internal Acc. | FS400069 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-22; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=7e-19; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=1e-18; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=3e-18; Gamma-glutamyltranspeptidase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-18; |
Length | 557 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GGCCTACTGTCCCCCCCACGGCCATTCTGTTAGTCATAGAGAGATGAGTAAACAGAATTT |
EST members of Unigene | FS400069 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |