Detail of EST/Unigene FS409053 |
Acc. | FS409053 |
Internal Acc. | FS409053 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=3e-55; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=3e-54; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=5e-22; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=1e-19; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=4e-15; |
Length | 603 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GGAGTTGGAGTAAGAATTAAAAGAAGATACTACTGTAGTAACATATTTCCAGCTAATAGC |
EST members of Unigene | FS409053 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |