Detail of EST/Unigene FS411334 |
Acc. | FS411334 |
Internal Acc. | FS411334 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Levopimaradiene synthase, chloroplastic OS=Ginkgo biloba E-value=1e-16; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=7e-15; Ent-copalyl diphosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-14; Ent-copalyl diphosphate synthase, chloroplastic OS=Pisum sativum E-value=3e-14; Ent-copalyl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-14; |
Length | 646 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GAGCGGAAAAATACAAAGCTTACCTCTCTCTCTCTCTCTCTCTCTCTCTCTATCCACATT |
EST members of Unigene | FS411334 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828182 |
Trichome-related Gene from Literature | 828182 |