| Detail of EST/Unigene FS411334 |
| Acc. | FS411334 |
| Internal Acc. | FS411334 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Levopimaradiene synthase, chloroplastic OS=Ginkgo biloba E-value=1e-16; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=7e-15; Ent-copalyl diphosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-14; Ent-copalyl diphosphate synthase, chloroplastic OS=Pisum sativum E-value=3e-14; Ent-copalyl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-14; |
| Length | 646 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
| Sequence | GAGCGGAAAAATACAAAGCTTACCTCTCTCTCTCTCTCTCTCTCTCTCTCTATCCACATT |
| EST members of Unigene | FS411334 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828182 |
| Trichome-related Gene from Literature | 828182 |