Detail of EST/Unigene FS413742 |
Acc. | FS413742 |
Internal Acc. | FS413742 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=7e-23; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=5e-21; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=5e-19; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=9e-19; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=1e-18; |
Length | 656 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (1 ESTs); |
Sequence | GGTACAACGTCCGTCATGTGTTTTAACTTTACCATGTTCTGCTCTGAGAGTGTTCAGTTA |
EST members of Unigene | FS413742 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |