Detail of EST/Unigene GD248512 |
Acc. | GD248512 |
Internal Acc. | HLUTR2CH_T3_015_H05_08FEB2006_033 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=0; Putative dTDP-D-glucose 4,6-dehydratase OS=Acanthamoeba polyphaga mimivirus E-value=5e-63; dTDP-D-glucose 4,6-dehydratase OS=Dictyostelium discoideum E-value=6e-63; |
Length | 729 nt |
Species | Humulus lupulus |
Belonged EST Libraries | HLUTR2CH (1 ESTs); |
Sequence | CAAATTTCAAGTTCGTTAAGGGGGACATTGGCAGTGCTGATCTTGTCAACTTTCTTTTAA |
EST members of Unigene | GD248512 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
EC | 4.2.1.46 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841785 |
Trichome-related Gene from Literature | 841785 |