Detail of EST/Unigene GE343373 |
Acc. | GE343373 |
Internal Acc. | MEUA054TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-92; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=9e-67; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=6e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=6e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum tuberosum E-value=1e-35; |
Length | 696 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CACTTCATTTATCCATCCAATTCCAATCTTATCGCTGAGAAAGTTGAAGTGTTCGTTCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |