Detail of EST/Unigene GE343516 |
Acc. | GE343516 |
Internal Acc. | MEUA218TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=8e-30; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=4e-29; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=8e-29; Glycine cleavage system H protein 1, mitochondrial OS=Arabidopsis thaliana E-value=4e-27; Glycine cleavage system H protein, mitochondrial OS=Flaveria trinervia E-value=8e-27; |
Length | 336 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AACAAGTGATGTAAACTCTCCAATATCTGGTGAGATTGTTGAAGTTAATGATAAGCTCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818104 |
Trichome-related Gene from Literature | N/A |