Detail of EST/Unigene GE343575 |
Acc. | GE343575 |
Internal Acc. | MEUA281TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-62; PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; PsbP domain-containing protein 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-07; PsbP domain-containing protein 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-07; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=4e-06; |
Length | 692 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | ATCCCTTCAGACTTCACCTACACTTCACAGAACTCTCTTTCAAAACTCTTTCCCTCAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824699 |
Trichome-related Gene from Literature | N/A |