Detail of EST/Unigene GE343610 |
Acc. | GE343610 |
Internal Acc. | MEUA322TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=0; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=0; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=0; Ketol-acid reductoisomerase, mitochondrial OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=2e-29; |
Length | 740 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGGGGGTTCACAGGGACCTGCTCAAGCACAGAATCTACGGGACTCACTTGCTGAAGCTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |