| Detail of EST/Unigene GE344137 |
| Acc. | GE344137 |
| Internal Acc. | MEUA937TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Inosine triphosphate pyrophosphatase OS=Vitis vinifera E-value=0; Inosine triphosphate pyrophosphatase OS=Arabidopsis thaliana E-value=8e-97; Inosine triphosphate pyrophosphatase OS=Sorghum bicolor E-value=3e-91; Inosine triphosphate pyrophosphatase OS=Oryza sativa subsp. japonica E-value=2e-89; Inosine triphosphate pyrophosphatase OS=Oryza sativa subsp. indica E-value=3e-89; |
| Length | 804 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGATTTTTCATGGCTTTAGTGTCTTTCGTTTGAGTGCTGTGTTCCAAAAGTCTCGATTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01519 nucleoside-triphosphate pyrophosphatase |
| EC | 3.-.-.- 3.6.1.19 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827006 |
| Trichome-related Gene from Literature | N/A |