Detail of EST/Unigene GE344191 |
Acc. | GE344191 |
Internal Acc. | MEUAA05TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=7e-49; Putative beta-glucosidase 5 OS=Arabidopsis thaliana E-value=6e-47; Beta-glucosidase 3 OS=Arabidopsis thaliana E-value=5e-46; Hydroxyisourate hydrolase OS=Glycine max E-value=2e-45; Beta-glucosidase 2 OS=Oryza sativa subsp. japonica E-value=8e-45; |
Length | 626 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GTGGGTTTAATCTCCTTGTTTTTGGTTTTGTTCCACTAACAAATACTAGTGAAGACATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |