| Detail of EST/Unigene GE344350 |
| Acc. | GE344350 |
| Internal Acc. | MEUAB89TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L20, chloroplastic OS=Lotus japonicus E-value=1e-38; 50S ribosomal protein L20, chloroplastic OS=Glycine max E-value=7e-38; 50S ribosomal protein L20, chloroplastic OS=Phaseolus vulgaris E-value=2e-35; 50S ribosomal protein L20, chloroplastic OS=Citrus sinensis E-value=2e-33; 50S ribosomal protein L20, chloroplastic OS=Morus indica E-value=5e-33; |
| Length | 538 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGAATTTTTATTTTATACATTGGAAAAATCCATTTTGTTATTAATAGACTAGGTAAGGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |