Detail of EST/Unigene GE344357 |
Acc. | GE344357 |
Internal Acc. | MEUAB96TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 5 OS=Homo sapiens E-value=2e-23; Replication factor C subunit 5 OS=Mus musculus E-value=2e-23; Probable replication factor C subunit 5 OS=Dictyostelium discoideum E-value=3e-21; Replication factor C subunit 3 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-12; Probable replication factor C subunit 5 OS=Caenorhabditis elegans E-value=2e-10; |
Length | 560 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AAGAAGCTGTTTATCTTTGCACTGGAAATCCGTTGCCCAAAGACATTGAGCAAATATCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10756 replication factor C subunit 3/5 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844083 |
Trichome-related Gene from Literature | N/A |