Detail of EST/Unigene GE344640 |
Acc. | GE344640 |
Internal Acc. | MEUAF18TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=3e-71; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=1e-70; Glutathione S-transferase OS=Hyoscyamus muticus E-value=5e-70; Glutathione S-transferase F7 OS=Arabidopsis thaliana E-value=5e-67; Glutathione S-transferase F6 OS=Arabidopsis thaliana E-value=2e-66; |
Length | 706 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGACAACTTACCAAAGTTAATTAAGAACAATAAATTAATCTTGTGATCGATTAATCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839295 |
Trichome-related Gene from Literature | N/A |