| Detail of EST/Unigene GE344666 |
| Acc. | GE344666 |
| Internal Acc. | MEUAF45TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-63; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=3e-26; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=2e-24; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=6e-18; Polyadenylate-binding protein 3 OS=Arabidopsis thaliana E-value=8e-16; |
| Length | 702 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | TTCTCTACTCTCACAACTCAATTTCCTTTCTCTAACTCACAACAACACTCACACAAACTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824379 |
| Trichome-related Gene from Literature | N/A |