Detail of EST/Unigene GE344666 |
Acc. | GE344666 |
Internal Acc. | MEUAF45TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-63; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=3e-26; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=2e-24; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=6e-18; Polyadenylate-binding protein 3 OS=Arabidopsis thaliana E-value=8e-16; |
Length | 702 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | TTCTCTACTCTCACAACTCAATTTCCTTTCTCTAACTCACAACAACACTCACACAAACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824379 |
Trichome-related Gene from Literature | N/A |