| Detail of EST/Unigene GE344753 |
| Acc. | GE344753 |
| Internal Acc. | MEUAG44TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl carrier protein 1, chloroplastic OS=Casuarina glauca E-value=7e-30; Acyl carrier protein 1, chloroplastic OS=Cuphea lanceolata E-value=3e-27; Acyl carrier protein 4, chloroplastic OS=Cuphea lanceolata E-value=4e-27; Acyl carrier protein 3, chloroplastic OS=Cuphea lanceolata E-value=1e-25; Acyl carrier protein 2, chloroplastic OS=Cuphea lanceolata E-value=1e-24; |
| Length | 563 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | TTCCATCACCACAACCTCCATGTCCCTCCTCTCCCTCTCCGACCAATCTATGGTTTCTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841900 |
| Trichome-related Gene from Literature | N/A |