Detail of EST/Unigene GE344766 |
Acc. | GE344766 |
Internal Acc. | MEUAG58TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=1e-49; Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=6e-49; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=1e-28; Flavonoid 3',5'-hydroxylase OS=Campanula medium E-value=2e-28; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=6e-28; |
Length | 796 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | ACAACAATACAACGTCAAGTAGTTAATTTGTTTTTCCCTATTCAAATAGATTGCTGTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1 |
EC | 1.14.14.1 1.14.99.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |