| Detail of EST/Unigene GE344818 |
| Acc. | GE344818 |
| Internal Acc. | MEUAH17TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=1e-55; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=1e-55; Dihydroflavonol-4-reductase OS=Arabidopsis thaliana E-value=1e-55; Dihydroflavonol-4-reductase OS=Zea mays E-value=4e-54; Dihydroflavonol-4-reductase OS=Hordeum vulgare E-value=3e-53; |
| Length | 721 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | TGAAGGAAAAGGAAGAGTTTGTGTGACTGGAGGTACAGGTTTTCTTGGTTCATGGATTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
| EC | 1.1.1.145 1.1.1.170 5.3.3.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819146 |
| Trichome-related Gene from Literature | N/A |