Detail of EST/Unigene GE344857 |
Acc. | GE344857 |
Internal Acc. | MEUAH62TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamyl-tRNA reductase 1, chloroplastic OS=Cucumis sativus E-value=2e-79; Glutamyl-tRNA reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-73; Glutamyl-tRNA reductase 1, chloroplastic OS=Hordeum vulgare E-value=3e-68; Glutamyl-tRNA reductase 2 (Fragment) OS=Hordeum vulgare E-value=1e-67; Glutamyl-tRNA reductase 2, chloroplastic OS=Cucumis sativus E-value=4e-67; |
Length | 694 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | TTCGTAGATATTTCTGTTCCGAGAAACGTAGGTTCATGTGTCGATGACCTTGAGTCTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842198 |
Trichome-related Gene from Literature | N/A |