| Detail of EST/Unigene GE344857 |
| Acc. | GE344857 |
| Internal Acc. | MEUAH62TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamyl-tRNA reductase 1, chloroplastic OS=Cucumis sativus E-value=2e-79; Glutamyl-tRNA reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-73; Glutamyl-tRNA reductase 1, chloroplastic OS=Hordeum vulgare E-value=3e-68; Glutamyl-tRNA reductase 2 (Fragment) OS=Hordeum vulgare E-value=1e-67; Glutamyl-tRNA reductase 2, chloroplastic OS=Cucumis sativus E-value=4e-67; |
| Length | 694 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | TTCGTAGATATTTCTGTTCCGAGAAACGTAGGTTCATGTGTCGATGACCTTGAGTCTGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842198 |
| Trichome-related Gene from Literature | N/A |