Detail of EST/Unigene GE344870 |
Acc. | GE344870 |
Internal Acc. | MEUAH77TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=2e-32; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=3e-29; Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=2e-21; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=2e-20; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-18; |
Length | 715 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGGCTCACCCTCTAATCTATGTTATATTTTTGTCCTGTTATTCTCACACCTCACTCTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838446 |
Trichome-related Gene from Literature | N/A |