| Detail of EST/Unigene GE344918 |
| Acc. | GE344918 |
| Internal Acc. | MEUAI38TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucuronate 4-epimerase 5 OS=Arabidopsis thaliana E-value=3e-84; UDP-glucuronate 4-epimerase 2 OS=Arabidopsis thaliana E-value=3e-83; UDP-glucuronate 4-epimerase 4 OS=Arabidopsis thaliana E-value=1e-82; UDP-glucuronate 4-epimerase 3 OS=Arabidopsis thaliana E-value=1e-82; UDP-glucuronate 4-epimerase 1 OS=Arabidopsis thaliana E-value=2e-78; |
| Length | 796 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGGAAATTGAACATGGGTGGCATAGGTATATTACCCTCAAAACCAGAAAAATATCATTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01784 UDP-glucose 4-epimerase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01784 UDP-glucose 4-epimerase |
| EC | 4.2.1.46 5.1.3.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826833 |
| Trichome-related Gene from Literature | N/A |