| Detail of EST/Unigene GE345050 |
| Acc. | GE345050 |
| Internal Acc. | MEUAJ83TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=4e-48; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=6e-46; Ferredoxin-6, chloroplastic OS=Zea mays E-value=2e-40; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-40; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=6e-39; |
| Length | 604 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGACTTACTTCATCATTGTAACATAATTCACATCGTTTTTTCCGCTTCCATCTCCAACTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817297 |
| Trichome-related Gene from Literature | N/A |