Detail of EST/Unigene GE345381 |
Acc. | GE345381 |
Internal Acc. | MEUAN61TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=1e-84; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=3e-56; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=7e-53; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=1e-52; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-52; |
Length | 812 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGATCAATCAAACAAGCAAAAACAGTTGTTAGAGCAAATAGTTGAAGCACTAAGATGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 820083 |
Trichome-related Gene from Literature | N/A |