| Detail of EST/Unigene GE345423 |
| Acc. | GE345423 |
| Internal Acc. | MEUAO10TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=2e-63; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=8e-50; Plastocyanin, chloroplastic OS=Spinacia oleracea E-value=4e-49; Plastocyanin, chloroplastic OS=Silene pratensis E-value=5e-49; Plastocyanin A, chloroplastic OS=Populus nigra E-value=1e-47; |
| Length | 636 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | ACCGTTACTTCCACCACCGTTGCTATTCCATCATTCACAGGCCTTAAGGCAAACGCAAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838622 |
| Trichome-related Gene from Literature | N/A |