| Detail of EST/Unigene GE345618 |
| Acc. | GE345618 |
| Internal Acc. | MEUAQ26TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytokinin hydroxylase OS=Arabidopsis thaliana E-value=5e-51; Secologanin synthase OS=Catharanthus roseus E-value=2e-48; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=3e-48; Cytochrome P450 734A6 OS=Oryza sativa subsp. japonica E-value=2e-47; Cytochrome P450 734A2 OS=Oryza sativa subsp. japonica E-value=8e-47; |
| Length | 727 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GCTGGTCATGAAACCACTTCAAACTTACTTAATTGGACCGTCTTTTTGTTGAGTTTGCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07424 cytochrome P450, family 3, subfamily A |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819309 |
| Trichome-related Gene from Literature | N/A |